Journal: bioRxiv

Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

doi: 10.64898/2026.03.13.711474

Figure Lengend Snippet: (A). Immunofluorescence (IF) images of in vivo AT2 transduction using AAV9. Green: eGFP; Red: proSPC. Yellow arrows indicate the AT2s (proSPC + ) that are infected by AAV9-eGFP. Scale bars, 50 μm. (B). Schematic of the SAGE (AAV-SBase-intron) system. (C). Experimental design for quantification of genome integration efficiency of engineered AAV systems. Lungs were harvested from mice seven days after i.t. administration. (D). Representative widefield images of the organoids grown from AT2s transduced by SAGE. mScarlet + AT2s were harvested as CD45 - Pdgfra - CD31 - EpCAM + MHCII + CD104 - . Scale bars, 200 μm. (E). Quantification for integration efficiency of AAV9 and SAGE using the AT2 clonal organoid assay. N = 3 and 12 mice were used for AAV9 and SAGE, respectively. Error bars: mean ± SEM. (F). IF images illustrating Sftpc gene knockout in AT2s. AT2-specific knockouts were achieved through AT2-Cas9-eGFP mice following tamoxifen treatment and subsequent SAGE gRNA delivery (detailed experimental scheme in ). A gRNA targeting the Tigre locus , a genomic safe harbor in the mouse genome, was used as a control. Green: eGFP representing Cas9 expression; yellow: mScarlet, representing SAGE transduction; cyan, proSPC. White dashed lines indicate AT2s expressing Cas9 and gRNA that have lost proSPC expression. White solid lines indicate AT2s expressing Cas9 and gRNA that have retained proSPC expression. Scale bars, 50 μm. (G). Quantification of proSPC knockout effects in AT2s that are mScarlet + eGFP + . N = 4 mice were used for each condition. Error bars: mean ± SEM.

Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

Techniques: Immunofluorescence, In Vivo, Transduction, Infection, Gene Knockout, Control, Expressing, Knock-Out

Journal: bioRxiv

Article Title: In vivo interrogation of transcriptional and epigenetic regulators of lung epithelial regeneration

doi: 10.64898/2026.03.13.711474

Figure Lengend Snippet: (A). Two color AAV experiments for quantitative assessment of multi-infection rate for AAV transduction in vivo . Mice were i.t. administered non-engineered eGFP-AAV9: mCherry-AAV9 at 1:1 ratio at indicated total viral loads (4 × 10 9 , 2 × 10 10 , or 1 × 10 11 ) and lungs were harvested five days later. Representative gates were pregated as CD45 - CD31 - Pdgfra - EpCAM + CD104 - MHCII + . (B). Pairwise scatter plots of gRNA abundance in libraries from plasmids, AAVs, and AT2s from biological replicates. (C). Pearson correlation of gRNA abundance in the CM screen derived from plasmids (P), packaged AAV libraries (AAV), and AT2s harvested after injury resolution. Pairwise correlations demonstrate high library representation fidelity across stages. (D). gRNA abundance log 2 fold change (LFC) of control gRNAs and Plk1 gRNAs in the CM and TF screens. Error bars: mean ± SEM. Statistical analysis was using the two-tailed Student’s t -tests. p-values are reported as follows: **p < 0.01.

Article Snippet: In brief, 5 μl of the fraction after ultracentrifugation, isolated AAVs or Addgene AAV standards (Adgene #37825-AAV9) were treated with with DNase I (Merck, 11284932001) at 37 °C for at least 1 hr, followed by Proteinase K digestion at 56 °C for at least 2 hrs before preparing a threefold serial dilutions with ddH2O. qPCR reactions with primers targeting the WPRE region (WPRE_F, CAATCCAGCGGACCTTCCTT; WPRE_rev, AGATCCGACTCGTCTGAGGG) for normal AAVs and the mScarlet region (mScarlet_F, AAGAAGCCCGTGCAGATGCC; mScarlet_R, GCCACGGAGCGTTCGTACTG) for SAGE were performed with 3 μl of the diluted AAV template, 5 μl Power SYBRTM Green PCR Master Mix (Thermo Fisher Scientific, 4368706), 2.5 μM of each primers in a total of 2 μl. qPCR was performed using RioRad CFX 384 system and at conditions as follows: (1) 95 °C for 10 min; (2) 40 cycles of 95 °C for 15 s and 60 °C for 1 min (40 cycles).

Techniques: Infection, Transduction, In Vivo, Derivative Assay, Control, Two Tailed Test

Journal: Nature Communications

Article Title: Motor learning and dopamine-dependent striatal synaptic plasticity are controlled by astrocytic MEGF10

doi: 10.1038/s41467-026-69129-1

Figure Lengend Snippet: a An experimental scheme. b Latency to fall during rotarod training of control and Megf10 cKO (black: Megf10 fl/fl , n = 9 mice, red: Aldh1l1-CreERT2; Megf10 fl/fl , n = 13 mice; two-way ANOVA). c Representative confocal z-stack images showing astrocytic phagocytosis of corticostriatal presynapses in the DLS from control ( Megf10 fl/fl) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. d Quantification of corticostriatal presynapses by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 9 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 6 mice, 5 days: n = 7 mice; one-way ANOVA). e Representative confocal z-stack images showing astrocytic phagocytosis of striatal postynapses in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training (top: mCherry (red), eGFP (cyan), and S100B (blue); bottom: mCherry-only (magenta), S100B (cyan)). Scale bar, 10 μm. f Quantification of striatal postsynaptic phagocytosis by astrocytes in the DLS from control ( Megf10 fl/fl ) and Megf10 cKO ( Aldh1l1-CreERT2; Megf10 fl/fl ) mice during rotarod training ( Megf10 fl/fl ; 0 days: n = 5 mice, 5 days: n = 4 mice; Aldh1l1-CreERT2; Megf10 fl/fl ; 0 days: n = 8 mice, 5 days: n = 6 mice; one-way ANOVA). g Schematic illustration of the experiment to knock out Megf10 astrocytes conditionally in the striatum. h Latency to fall during the accelerating rotarod task of the control group ( GfaABC1D-Gfp , green) and the Megf10 cKO group ( GfaABC1D-Cre , yellow) ( GfaABC1D-Gfp : n = 9 mice, GfaABC1D-Cre : n = 10 mice; two-way ANOVA). i A schematic illustration of the stimulation site in the corticostriatal pathway and the whole-cell patch-clamp recording in the DLS of a horizontal brain slice. Created in BioRender. Chung, W. (2026) https://BioRender.com/spxps4n . j Representative recording traces (left) and summary statistics (right) depicting the I/O relationships at corticostriatal excitatory synapses (Control, n = 19 cells from 5 mice; Megf10 cKO, n = 21 cells from 5 mice; RM two-way ANOVA). k Representative recording traces (left) and summary statistics (right) illustrating the AMPA/NMDA ratio at corticostriatal synapses (Control, n = 11 cells from 3 mice; Megf10 cKO, n = 11 cells from 4 mice; unpaired two-sided t -test). Data were presented as mean values ± SEM. AU arbitrary units.

Article Snippet: To generate the pAAV- GfaABC1D-GFP construct, the eGFP construct from pAAV- CAG-GFP (Addgene #28014) were amplified by PCR and subcloned into pAAV- GfaABC1D-Cre (Addgene #1056063).

Techniques: Control, Knock-Out, Patch Clamp, Slice Preparation

Journal: bioRxiv

Article Title: Soluble DLK1 secreted by telomere-shortening-induced senescent microglia impairs oligodendrocyte functions and alters neuronal activity

doi: 10.64898/2026.01.14.699608

Figure Lengend Snippet: A. Schematic showing the IV injection of the AAV-EGFP or AAV-sDLK1-T2A-GFP into the mice. B. Quantification of the protein levels of sDLK1 in the cortex of the mice, measured by mouse DLK1 ELISA. C. Distributions of the normalized numbers of genes up-regulated (top) and down-regulated (bottom) in different cell types of the mice injected with AAV-sDLK1-T2A-GFP, compared to mice injected with AAV-EGFP. The gene burden score is defined as the number of differentially expressed genes per 1000 UMI detected in each cell type. D. Scatter plot showing the positively correlated genes between DEGs in G3 Terc-/- and AAV-sDLK1-T2A-GFP injected oligodendrocytes. E. Western blot of MBP (top) and MOBP (bottom). F–G. Quantification of the MBP (F) and MOBP (G) western blot. Data were analyzed by two-tailed unpaired t -test. ** p =0.0095 (MBP); *** p =0.0009 (MOBP). H. Ridge plot of the predicted chronological ages for oligodendrocytes in the mice injected with AAV-EGFP (top) and AAV-sDLK1-T2A-GFP (bottom). I. Quantification of the predicted age of oligodendrocytes. Data were reported as a box & whisker plot showing min to max and analyzed by t-test. Each dot represents a cell. **** p < 0.0001. J. UMAP plot showing the enrichment of OPC2 caused by increased sDLK1. K. Ratios of each OPC cluster. Data are reported as mean ± s.e.m. and analyzed by two-way ANOVA. * p =0.0432. L. Running enrichment score and pre-ranked list showing a negative enrichment of oligodendrocyte differentiation predicted by OPC3 markers

Article Snippet: Intravenous injections of AAV particles encoding mouse sDLK1 were performed in C57BL/6 mice, while PHP.eB AAV encoding GFP alone (Addgene, 37825-PHP.eB) served as a negative control.

Techniques: IV Injection, Enzyme-linked Immunosorbent Assay, Injection, Western Blot, Two Tailed Test, Whisker Assay

Journal: bioRxiv

Article Title: Soluble DLK1 secreted by telomere-shortening-induced senescent microglia impairs oligodendrocyte functions and alters neuronal activity

doi: 10.64898/2026.01.14.699608

Figure Lengend Snippet: A. UMAP plots showing eight major cell types identified in the mouse hippocampus. B. Dot plot showing expression levels of canonical cell markers in each identified cell type. C. Proportion of each cell type within animals injected with AAV-GFP and AAV-sDLK1-T2A-GFP. D. Proportion of each cell type within individual samples. E. Violin plots showing the number of unique features (left); the number of total RNA count (middle), and the percentage of mitochondrial genes (right) detected in each identified cell type. F. Correlation between UMI counts and percentage of mitochondrial genes (left) or total gene counts (right) per nuclei for each individual sample.

Article Snippet: Intravenous injections of AAV particles encoding mouse sDLK1 were performed in C57BL/6 mice, while PHP.eB AAV encoding GFP alone (Addgene, 37825-PHP.eB) served as a negative control.

Techniques: Expressing, Injection

Journal: bioRxiv

Article Title: Soluble DLK1 secreted by telomere-shortening-induced senescent microglia impairs oligodendrocyte functions and alters neuronal activity

doi: 10.64898/2026.01.14.699608

Figure Lengend Snippet: A. Dot plot showing the expression level of DLK1 in different cell types in the hippocampus tissue. The size of each dot represents the percentage of cells with detected DLK1 mRNA. B. Chord diagram showing DLK signaling predicted by CellChat. The lengths of the segmented outer circle reflect the expression levels of ligand proteins in each cell type and of receptor proteins in the receiving cells, showing strong expression of DLK1 signaling originating from interneurons and astrocytes to oligodendrocytes and OPCs. C. Bubble plot showing the DLK1 interactions originating from interneurons and astrocytes to different receptors. D. Venn diagram showing the overlap of upregulated DEGs in G3 Terc-/- and AAV-sDLK1-T2A-GFP injected oligodendrocyte(top) and the overlap of downregulated DEGs in G3 Terc-/-and AAV-sDLK1-T2A-GFP injected oligodendrocyte (bottom). E. Dot plot showing the change of expression levels of myelination proteins in oligodendrocytes caused by the increase of sDLK1. F. Cnet plot showing the network of genes associated with myelination-related Gene Ontology terms and myelin-related diseases, based on enrichment analysis of the top 500 differentially expressed genes in oligodendrocytes from mice with AAV-sDLK1-T2A-GFP versus mice with AAV-GFP. Nodes represent genes or GO terms; edge colors represent the pathways each node is involved in.

Article Snippet: Intravenous injections of AAV particles encoding mouse sDLK1 were performed in C57BL/6 mice, while PHP.eB AAV encoding GFP alone (Addgene, 37825-PHP.eB) served as a negative control.

Techniques: Expressing, Injection

Journal: bioRxiv

Article Title: Soluble DLK1 secreted by telomere-shortening-induced senescent microglia impairs oligodendrocyte functions and alters neuronal activity

doi: 10.64898/2026.01.14.699608

Figure Lengend Snippet: A. Representative 20X images of Olig2 in the CA1 region of the hippocampus in C57BL/6 mice injected with either AAV-GFP or AAV-sDLK1-T2A-GFP. Scale bar represents 100 µm. B. Quantification of Olig2+ cell density in CA1. N = 5 mice injected with AAV-GFP and N = 4 mice injected with AAV-sDLK1-T2A-GFP. 2-3 hippocampal sections/mouse were imaged and analyzed. Data are reported as mean ± SEM. p = 0.9480. Data were analyzed by unpaired t-test. C. Quantification of Olig2+ cell density in CA3. N = 5 mice injected with AAV-GFP and N = 4 mice injected with AAV-sDLK1-T2A-GFP. 2-3 hippocampal sections/mouse were imaged and analyzed. Data are reported as mean ± SEM. p = 0.2008. Data were analyzed by unpaired t-test. D. Representative 20X images of PDGFRα in the CA1 region of the hippocampus in C57BL/6 mice injected with either AAV-GFP or AAV-sDLK1-T2A-GFP. Scale bar represents 100 µm. E. Quantification of PDGFRα+ cell density in CA1. N = 5 mice/treatment group and 2-3 hippocampal sections/mouse were imaged and analyzed. Data are reported as mean ± SEM. p = 0.3534. Data were analyzed by unpaired t-test. F. Quantification of PDGFRα+ cell density in CA3. N = 5 mice/treatment group and 2-3 hippocampal sections/mouse were imaged and analyzed. Data are reported as mean ± SEM. p = 0.6744. Data were analyzed by unpaired t-test.

Article Snippet: Intravenous injections of AAV particles encoding mouse sDLK1 were performed in C57BL/6 mice, while PHP.eB AAV encoding GFP alone (Addgene, 37825-PHP.eB) served as a negative control.

Techniques: Injection

Journal: bioRxiv

Article Title: Soluble DLK1 secreted by telomere-shortening-induced senescent microglia impairs oligodendrocyte functions and alters neuronal activity

doi: 10.64898/2026.01.14.699608

Figure Lengend Snippet: A Venn diagram showing the overlap of upregulated (top) and downregulated (bottom) DEGs in G3 Terc-/- and AAV-sDLK1-T2A-GFP -injected excitatory neurons. B. Dot plot of the top 10 Reactome pathways inferred by the upregulated overlapping DEGs in G3 Terc-/- and AAV-sDLK1-T2A-GFP injected excitatory neurons. C–D. Running enrichment score and pre-ranked list showing a positive (C) and negative (D) enrichment of calcium ion transmembrane transport predicted by the upregulated overlapping DEGs in G3 Terc-/- and AAV-sDLK1-T2A-GFP injected excitatory neurons. E. Schematic illustrating the experiment setup to test the chronic effects of DLK1 on neuronal activities. F. Representative fluorescence image of human iPSC-derived neurons expressing GCaMP8f showing spontaneous activity. G. Representative spontaneous calcium traces. H–J. Quantification of synchronized firing rate (H). firing amplitude (I), or spontaneous firing rate (J). K. Representative averaged calcium traces from one KCl stimulation experiment in neurons treated with DLK1 (red) and the untreated control neurons (black). Recording 400 seconds. Mean± s.e.m. L–N. Quantification of peak amplitude (L), the delayed KCl stimulation-induced neuronal responses (M), the time each neuron spent to reach peak intensity (N), from KCl stimulation-induced neuronal responses. Data are presented as mean ± s.e.m. and analyzed by unpaired t -test. ** p =0.0055 (L) **** p <0.0001 (N).

Article Snippet: Intravenous injections of AAV particles encoding mouse sDLK1 were performed in C57BL/6 mice, while PHP.eB AAV encoding GFP alone (Addgene, 37825-PHP.eB) served as a negative control.

Techniques: Injection, Fluorescence, Derivative Assay, Expressing, Activity Assay, Control

Journal: Molecular Therapy. Nucleic Acids

Article Title: Ineffective behavioral rescue despite partial brain Dp427 restoration by AAV9-U7-mediated exon 51 skipping in mdx52 mice

doi: 10.1016/j.omtn.2025.102779

Figure Lengend Snippet: Dp427 restoration 9 weeks after bilateral ICV injection of AAV9-U7-51M (A) Schematic representation of the U7snRNA and its target site on dystrophin pre-mRNA. (B) Structure of the AAV vector encoding the U7snRNA cassette. The cassette is flanked by inverted terminal repeats (ITRs) and includes an engineered U7snRNA sequence (gray box) with an antisense region, driven by its natural U7 promoter (hatched box) and 3′ downstream elements (white box). (C) Overview of the experimental procedure. (D) Left: RT-PCR gel showing exon 51 skipping 9 weeks post-injection. SM: DNA ladder; Mouse 0: mdx52 mouse injected with U7-Scramble (negative control); Mice 1–7: mdx52 mice treated with a low dose of AAV9-U7-51M (1E11 vg); Mice 8–15: mdx52 mice treated with a high dose of AAV9-U7-51M (1E12 vg). Right: Quantification of exon 51 skipping via RT-qPCR, comparing low- and high-dose treatments ( n = 7 for low dose in orange and 8 for high dose in red). (E) Quantification of Dp427 protein restoration by western blot after AAV9-U7-51M injection at low and high doses expressed in a percentage of the WT ( n = 7 for low dose in orange and 8 for high dose in red). Statistical analysis (two-way ANOVA) did not reveal a dose-dependent effect due to high interindividual variability. (F) Combined analysis of Dp427 protein rescue levels irrespective of the injected dose expressed in a percentage of the WT ( n = 15) in the three brain structures.

Article Snippet: The resulting U7snRNA fragments were cloned between the inverted terminal repeats (ITRs) of a self-complementary AAV vector (pscAAV, Addgene plasmid #83279; gift from Mark Kay) for subsequent AAV production.

Techniques: Injection, Plasmid Preparation, Sequencing, Reverse Transcription Polymerase Chain Reaction, Negative Control, Quantitative RT-PCR, Western Blot